FASTQ
Results of sanger sequencing are usually fasta
files obtained from processing chromatograms.
Most high-throughput sequencing (HTS) machines output fastq
files, the “de facto” current standard in HTS.
Like fasta
, fastq
files are simply text files, but where each block of information in this format is encoded as 4 lines:
@read_identifier
read_sequence
+ separator line
base_qualities
For example, here you have 8 lines of a fastq file, corresponding to 2 sequences:
@HWI-M01876:76:000000000-AF16W:1:1101:10853:1000 1:N:0:CGTGACAGAT
NTGTACTTCATCCGAAACTCGTGCTCATCTCTGCTCAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTGAT
+
#8ABCFGGGFCEDCFGGGGGGGFFCGEFGGGGGGFGGGGGGGGDEFGGGGGGGGGGGGGGGGGFFFEGGGGGGGGF
@HWI-M01876:76:000000000-AF16W:1:1101:16471:1000 1:N:0:CGTGAACTTG
NTTCCAGATATTCGATGCATGTGCCGCTCCTGTCGGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTGAT
+
#8BCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGG
Q is for Quality
Each base has a quality character associated with it, representing how confidently the machine identified (called) the base. The probability of error per base is given as a Phred score, $Q$, calculated from an integer value derived from the quality character associated to the base. This error probability, $P$ is computed with
$$ P = 10^{-Q/10}. $$Useful reference values of Q include:
- $Q = 10$ represents 90% accuracy (0.1 error)
- $Q = 20$ represents 99% accuracy (0.01 error)
- $Q = 30$ represents 99.9% accuracy (0.001 error)
- $Q = 40$ represents 99.99% accuracy (0.0001 error)
- $Q = 50$ represents 99.999% accuracy (0.00001 error)
Although there’s theoretically no limit, $Q$ usually goes up to around 40 in recent illumina machines.
ASCII table
To obtain this $Q$ value from the character associated to the quality of the base, we have to know that each character (such as #
) has an ASCII decimal value associated.
For example, #
has a value of 35.
Dec Char Dec Char Dec Char Dec Char
--------- --------- --------- ----------
0 NUL (null) 32 SPACE 64 @ 96 `
1 SOH (start of heading) 33 ! 65 A 97 a
2 STX (start of text) 34 " 66 B 98 b
3 ETX (end of text) 35 # 67 C 99 c
4 EOT (end of transmission) 36 $ 68 D 100 d
5 ENQ (enquiry) 37 % 69 E 101 e
6 ACK (acknowledge) 38 & 70 F 102 f
7 BEL (bell) 39 ' 71 G 103 g
8 BS (backspace) 40 ( 72 H 104 h
9 TAB (horizontal tab) 41 ) 73 I 105 i
10 LF (NL line feed, new line) 42 * 74 J 106 j
11 VT (vertical tab) 43 + 75 K 107 k
12 FF (NP form feed, new page) 44 , 76 L 108 l
13 CR (carriage return) 45 - 77 M 109 m
14 SO (shift out) 46 . 78 N 110 n
15 SI (shift in) 47 / 79 O 111 o
16 DLE (data link escape) 48 0 80 P 112 p
17 DC1 (device control 1) 49 1 81 Q 113 q
18 DC2 (device control 2) 50 2 82 R 114 r
19 DC3 (device control 3) 51 3 83 S 115 s
20 DC4 (device control 4) 52 4 84 T 116 t
21 NAK (negative acknowledge) 53 5 85 U 117 u
22 SYN (synchronous idle) 54 6 86 V 118 v
23 ETB (end of trans. block) 55 7 87 W 119 w
24 CAN (cancel) 56 8 88 X 120 x
25 EM (end of medium) 57 9 89 Y 121 y
26 SUB (substitute) 58 : 90 Z 122 z
27 ESC (escape) 59 ; 91 [ 123 {
28 FS (file separator) 60 < 92 \ 124 |
29 GS (group separator) 61 = 93 ] 125 }
30 RS (record separator) 62 > 94 ^ 126 ~
31 US (unit separator) 63 ? 95 _ 127 DEL
The $Q$ value of a character is the decimal value corresponding to the entry of that character in the ASCII table, subtracted by 33.
For example $Q$(#
) = 35 – 33 = 2.
!!! important “Why do we subtract by 33?”
All ASCII decimal values lower than 33 are not visible characters.
For example, the `NUL` character is not really visible in a text file; same with `CAN` for cancel.
`!` has the lowest ASCII decimal value that is usable in a text file.
Computing error
Looking at the first read of our fastq example,
@HWI-M01876:76:000000000-AF16W:1:1101:10853:1000 1:N:0:CGTGACAGAT
NTGTACTTCATCCGAAACTCGTGCTCATCTCTGCTCAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTGAT
+
#8ABCFGGGFCEDCFGGGGGGGFFCGEFGGGGGGFGGGGGGGGDEFGGGGGGGGGGGGGGGGGFFFEGGGGGGGGF
@HWI-M01876:76:000000000-AF16W:1:1101:16471:1000 1:N:0:CGTGAACTTG
NTTCCAGATATTCGATGCATGTGCCGCTCCTGTCGGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTGAT
+
#8BCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGG
we can see it starts with N
(unknown), with an associated quality character #
.
To know how confident the machine was in reading that base, we calculate:
- $Q$ = 35 (ASCII decimal value of
#
) - 33 (ASCII decimal value of!
) = 2 - $P = 10^{-2/10}$ = 0.631 (63.1% probability of error)
Given this probability of error, it is not surprising that the machine could not confidently say which base was in that position and therefore placed an N
in that position.
It is fairly common that in the first bases the machine is still calibrating, and sometimes there is less confidence in the called base.
Many sequencing machines can read both ends of a fragment.
In this case, the machine will generate two paired fastq
files, one with the forward reads and another with the reverse reads.
You can find an example of this is the example fastq files paired_end_example_1
(containing the forward reads) and paired_end_example_2
(containing the reverse reads).
These fastq are paired because the reads for the same fragment are in the same order in the two files.
For example, the first read in the forward fastq corresponds to the forward reading of the same fragment as the first read in the reverse fastq.
Acknowledgements
Parts of this material were adapted with permission from the following sources: